Penicillium sp. FKI-4410

ClassificationFungi
Last Updated :2019/05/21

Microorganisms Information

Code

  • FCM00276

Class

  • Fungi

Full Name

  • Penicillium sp. FKI-4410

Name

  • Penicillium sp.

Strain Num

  • FKI-4410

Source/Collection Site

  • Soil, Japan

Genetic Information

  • ITS

Nucleotide Sequence

  • >FKI-4410 GAACCTGCGGAAGGATCATTACTGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTGTACCTTGTTGCT TCGGCAGGCCCGCCTCACGGCCGCCGGGGGGCTTCTGCCCCCGGGCCCGCGCCTGCCGGAGACAATCTTGAACGCTGTC TGAAGAATGCAGTCTGAGCGATTAGCAAAATTAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAG AACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCC TGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTGTTCCCCCG GGAACAGGCCCGAAAGGCAGTGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCC GGCCGGCGCTTGCCGACCCCCATCAATCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCA TATCAATAAGGCAG

Products

Other information

Microorganisms Images



© KITASATO UNIVERSITY All Rights Reserved.